Journal: bioRxiv

Article Title: A high-density lineage tree reveals dynamics of expression differences accumulation in nondifferentiating clonal expansion

doi: 10.1101/2021.11.24.469964

Figure Lengend Snippet: ( A ) RT-PCR results for the RNA expression levels of the STADT barcode and Cas9 in cells growing in the presence of different concentrations of cumate. GAPDH was used as an internal control. The STADT barcode and Cas9 were amplified for 30 cycles, while GAPDH was amplified for 26 cycles. ( B ) RT-qPCR results for the expression levels of the STADT barcode relative to those of GAPDH. ( C ) RT-qPCR results for the expression levels of the Cas9 gene relative to those of GAPDH in cells cultured with different concentrations of cumate. ( D ) Western blot of the expression levels of Cas9 in cells cultured with different concentrations of cumate. GAPDH was used as an internal control. The small bands (*) may have resulted from the degradation of the Cas9 protein. ( E ) RT-PCR results showing the expression levels of sgRNA1 in the cells infected with different MOIs (0.1, 30) of the sgRNA lentivirus. U6 was used as an internal control. sgRNA1 was amplified for 35 cycles, while U6 was amplified for 30 cycles. ( F ) RT-qPCR result showing the expression level of sgRNA1 relative to that of U6 in the cell lines infected with different MOIs (0.1, 30) of the sgRNA lentivirus.

Article Snippet: For the sgRNAs, two DNA cassettes, U6>sgRNA1-U6>sgRNA2 and U6>sgRNA3-U6>sgRNA4, were synthesized and subsequently combined by Golden Gate ligation in the sgRNA vector pLV-U6>sgRNA1-U6>sgRNA2-U6>sgRNA3-U6>sgRNA4 (VectorBuilder, no. VB180515-1178wxn).

Techniques: Reverse Transcription Polymerase Chain Reaction, RNA Expression, Amplification, Quantitative RT-PCR, Expressing, Cell Culture, Western Blot, Infection

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A)Top panel, a schematic showing the strategy of generating Pten/Kdm5b mutant mice. Bottom panel, the actual sizes of representative biopsies of anterior prostates (AP) from Wt, Ptenpc–/–, Kdm5bpc–/–, and Ptenpc–/–; Kdm5bpc–/– mice at 6 months of age. (B) Quantification of AP weights from indicated genotypes of mice at 6 months of age. The averages of AP weight and numbers of mice for each cohort are indicated. (C) H&E staining of AP from indicated genotypes of mice at 6 months of age (Magnification: 4X and 20X). (D) Comparison of the onset of PIN in prostate glands between Ptenpc–/– and Ptenpc–/–; Kdm5bpc–/– mice. Error bars represent means ± SD (3 mice/group).

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Mutagenesis, Staining, Comparison

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) Immunohistochemical (IHC) staining for pAKT(S473), Ki67 and TUNEL in prostate tissues from indicated genotypes of mice at 6 months of age (Magnification: 20X). (B) Quantification of the prostate cells positive for pAKT(S473), Ki67 and TUNEL in (A). Error bars represent means ± SD from 3 mice for each group. (C) Western blotting analysis of protein levels of Pten, Kdm5b, pAKT, P110α, and P85 in prostate tissues of mice with indicated genotypes. Two mouse prostate samples for each genotype. (D) Quantification of protein levels for pAKT, P110α, and P85 between Pten/Kdm5b double null and Pten null mice. Error bars represent means ± SD of triplicates.

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Immunohistochemical staining, Immunohistochemistry, TUNEL Assay, Western Blot

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) Western blotting analysis showing the increased levels of P110α and pAKT (Ser473/Thr308) in BHPrE1 cells upon KDM5B overexpression. (B) Quantification of the levels for P110α and pAKT in BHPrE1 cells from (A). (C) Western blotting analysis showing that the effects of KDM5B restoration on the levels of P110α, P85 and pAKT (Ser473/Thr308) in LNCaP KDM5B-KO cells. (D) Quantification of the protein levels for pAKT, P110α and P85 in LNCaP KDM5B-KO cells from (C). (E) Western blotting analysis showing the differential responses between PC3 KDM5B-KO and the parental control cells to IGF-1 stimulation. (F) Quantification of protein levels for pAKT (Ser473/Thr308), P110α, and P85 in (E). Error bars represent means ±SD of triplicates.

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Western Blot, Over Expression, Control

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) Effects of Kdm5b inactivation on the cell proliferation of MEFs. Error bars represent means ± SD of triplicates. (B) Western blotting analysis of protein levels of Pten, Kdm5b, pAKT, P110α, P85, and β-galactosidase in MEFs with indicated genotypes. (C) Quantification of protein levels for pAKT, P110α, P85, and β-galactosidase between Pten/Kdm5b double null and Pten null MEFs. Error bars represent means ±SD of triplicates. (D) Immunofluorescence (IF) images showing the levels and membrane localization of PIP3 in MEFs with indicated genotypes. (E) Quantification of fluorescence intensities for PIP3 levels in MEFs. Error bars represent means ± SD (20 cells/ group). (F) Images showing the β-galactosidase staining in senescent MEFs. (G) Quantification of the MEFs positive for β-galactosidase. Error bars represent means ± SD (30 cells/ group).

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Western Blot, Immunofluorescence, Membrane, Fluorescence, Staining

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) Left panel, western blotting analysis showing the protein levels of KDM5B, pAKT, P110α, and P85 in LNCaP KDM5B-KO and the parental control human PCa cells. Right panel, quantification analysis of pAKT, P110α, and P85 in LNCaP KDM5B-KO and the control cells. (B) A comparison of the cell proliferation between LNCaP KDM5B-KO and the control cells. (C) Immunofluorescence (IF) images and analysis of PIP3 in LNCaP KDM5B-KO cells. Left panel, IF images showing the levels and membrane localization of PIP3 in LNCaP KDM5B-KO cells and the control cells. Right panel, quantification of the fluorescence intensities of PIP3 in LNCaP KDM5B-KO and the control cells. Error bars represent means ± SD (20 cells/group). (D) RNA-Seq peaks showing the changes of KDM5B, IRS1, PIK3CA, and PIK3R1 expression between LNCaP KDM5B-KO and the control cells. (E) Quantitative RT-PCR analysis to show the relative mRNA levels of IRS1, PIK3CA, and PIK3R1 in LNCaP KDM5B-KO cells. (F) Top panel, western blotting analysis showing the protein levels of KDM5B, P110α and P85 in LNCaP KDM5B-KO and the control cells at indicated time points in CHX chase experiments. Bottom panel, quantification of protein remaining for P110α and P85 at indicated time points in KDM5B-KO and the control cells.

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Western Blot, Control, Comparison, Immunofluorescence, Membrane, Fluorescence, RNA Sequencing, Expressing, Quantitative RT-PCR

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) A schematic showing the positions of 5 amplicons relative to the PIK3CA transcription start site (TSS). (B) ChIP analysis of KDM5B levels at the indicated regions near PIK3CA TSS in LNCaP KDM5B-KO and the parental control cells. (C) ChIP analysis of H3K4me3 levels at the indicated regions near PIK3CA TSS in LNCaP KDM5B-KO and the control cells. (D) Top panel, a schematic showing that KDM5B regulates the transcription of PIK3CA through affecting promoter activities. Bottom panel, comparisons of luciferase activities of the PIK3CA promoter between LNCaP KDM5B-KO cells and the parental control cells. (E) Luciferase activities showing the effects of KDM5B restoration on the PIK3CA promoter activities in LNCaP KDM5B-KO cells.

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Control, Luciferase

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A) Northern blot analysis of NHSL1 expression in different tissues. The arrow shows a large 5.5kb cDNA that is ubiquitously expressed but low in heart and spleen and not in testis. (B ) Western blots detecting NHSL3 protein in the B16-F1 melanoma cell line using the polyclonal antibody (3915); HSC70 serves as the loading control. (C) C-terminal EGFP-tagged NHSL3 was expressed in B16-F1 cells and, after plating on laminin, localisation was imaged live. Representative images shown from three independent experiments. Scale bar: 20 μm. Inset represents a magnified view of the white box. See also related video S1. (D) Intron and exon structure of NHSL3 isoforms is depicted with exon size in base pair length (bp) for Homo sapiens or Mus musculus below.

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Northern Blot, Expressing, Western Blot, Control

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A) Multiple Alignment using Fast Fourier Transform (MAFFT) was performed on the EBI server ( https://www.ebi.ac.uk/jdispatcher/msa/mafft?stype=protein ) using proteins sequences of human NHS (NP_001278796.1), NHSL1 (XP_011534278.2), NHSL2 (XP_047298020.1), and NHSL3/KIAA5122 (NP_065939.2).

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques:

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: ( A ) Myc-tagged CYFIP2, Nap1, Abi1, Scar/WAVE2, and HSPC300 were co-expressed with NHSL3-EGFP in HEK cells. EGFP-tagged NHSL3 was immunoprecipitated from cell lysates using NHSL3 polyclonal antiserum or normal rabbit IgG as negative control and blots were probed using antibodies against Myc and EGFP. Blot representative of three independent experiments. ( B,C ) Endogenous NHSL3 was immunoprecipitated with NHSL3 polyclonal antiserum or normal rabbit IgG as negative control from B16-F1 lysates, blotted and probed using antibodies against Scar/WAVE2 (B) or Abi1 (C) and NHSL3. Blot representative of 3 independent experiments. ( D-F ) Far western blot experiments using (D) six GST-tagged NHSL3 fragments (Fragment 1 - 6 in (E)) or (F) five sub-fragments of GST-3 (sub-fragment GST-3.1-3.5 in (E)) overlaid with purified MBP-Abi1 or MBP-Abi1ΔSH3 or MBP as negative control. GST-fusion protein containing several Abi SH3 binding motifs of the Lamellipodin protein served as a positive control and GST alone as the negative control. For (D,F) four independent experiments. (E) Schematic overview of the six GST-tagged fragments covering the entire amino acid sequence of NHSL3 and overlapping sub-fragments of fragment 3. The numbering refers to the amino acid numbers at the start and end of each fragment referring to murine NHSL3 isoform c (mmNHSL3 transcript variant 3 with exon1c; Genbank No: NM_001285866).

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Immunoprecipitation, Negative Control, Far Western Blot, Purification, Binding Assay, Positive Control, Sequencing, Variant Assay

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A-D) Still images from live cell imaging showing NHSL3-EGFP co-expressed with mScarlet-I-tagged Mena (A) , -Scar/WAVE2 (B) , -Abi1 (C) and - Nap1 (D) in B16-F1 cells. Representative images shown from three independent experiments. Scale bar in (A) for (A-D) represent 20 µm. See also related videos S2-5.

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Live Cell Imaging

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A,B) Still images from live cell imaging showing NHSL3-EGFP co-expressed with mScarlet-I-tagged -Scar/WAVE1 (A) , -Scar/WAVE3 (B) in B16-F1 cells. Representative images shown from three independent experiments. Scale bar in (A) for (A,B) represent 20 µm. Data relates to . See also related videos S6-7.

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Live Cell Imaging

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A-C) Endogenous NHSL3 co-localises with Mena (A, NHSL3 pAb; Mena mAb), Scar/WAVE1 (B, NHSL1 pAb; Scar/WAVE1 mAb ) , and Abi1 (C, NHSL1 pAb; Abi1 mAb ) at the edge of lamellipodia in B16-F1 mouse melanoma cells. Scale bar in (A) applies also to (B,C): 20 µm. Inset represents a magnified view of the white box. Scale bar in inset in (A) applies also to inset for (B,C): 20 μm. Representative images shown from three independent experiments.

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques:

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: ( A-B ) Myc-VASP, Myc-Mena or Myc-EVL were co-expressed with NHSL3-EGFP or EGFP alone in HEK cells. EGFP-tagged NHSL3 was pulled down from cell lysates (A) using a nanobody against EGFP (B) and blots were probed using antibodies against Myc and EGFP. Blot representative of four independent experiments. ( C ) Endogenous NHSL3 was immunoprecipitated with NHSL3 polyclonal antiserum or normal rabbit IgG as negative control from B16-F1 lysates, blotted and probed using antibodies against Mena and NHSL3. Blot representative of 3 independent experiments. ( D ) NHSL3-EGFP was expressed in HEK cells. Purified GST-tagged EVH1 domains, or GST only (E: Coomassie gel) as negative control, were used to pull down associated proteins from HEK lysates and blots were probed using an antibody against EGFP. Blots representative of three individual experiments. (E) Coomassie stained SDS-PAGE gels depicting purified GST or GST-tagged EVH1 domains from VASP, Mena, or EVL. ( F ) Myc-tagged Mena was co-expressed with EGFP only as control or EGFP-tagged wild-type NHSL3, EGFP-tagged NHSL3 with the first or second FP4 motif mutated (FP4-1 Mutant or FP4-2 Mutant), with both FP4 motifs mutated (FP4-1/2 Mutant), or with both FP4 motifs and the Abi SH3 domain binding site mutated (FP4-1/2+SH3 Mutant). Transfected EGFP-tagged proteins were pulled down from lysates using a nanobody against EGFP and blots were probed using antibodies against Myc and EGFP. Blot representative of four independent experiments.

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Immunoprecipitation, Negative Control, Purification, Staining, SDS Page, Control, Mutagenesis, Binding Assay, Transfection

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A) The sequence of the two consecutive Ena/VASP EVH1 domain binding sites in NHSL3: EVH1 site 1 (EVH1-1 shown in blue) or EVH1 site 2 (EVH1-2 shown in green) and respective mutations (shown in red) introduced in the EVH1 site 1 (NHSL3 ΔEVH1– ), in the EVH1 site 2 (NHSL3 ΔEVH1–2 ), or both sites (NHSL3 ΔEVH1–/1 ) are shown. The amino acid numbering refers to murine NHSL3 isoform c (mmNHSL3 transcript variant 3 with exon1c; Genbank No: NM_001285866). Data relates to .

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Sequencing, Binding Assay, Variant Assay

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: ( A ) Myc-tagged Abi1 was co-expressed with wild-type NHSL3-EGFP, EGFP-tagged NHSL3 with the Abi SH3 domain binding site mutated (NHSL3 ΔSH3 -EGFP) or the first and second Ena/VASP binding site mutated (NHSL3 ΔFP41/2 -EGFP). EGFP-tagged NHSL3 was immunoprecipitated from cell lysates using NHSL3 polyclonal antiserum or normal rabbit IgG as negative control and blots were probed using antibodies against Myc and EGFP. Blot representative of three independent experiments. ( B ) Myc-tagged CYFIP2, Nap1, Scar/WAVE2, Abi1, and HSPC300 were co-expressed with wild-type NHSL3-EGFP, EGFP-tagged NHSL3 with the Abi SH3 domain binding site mutated (NHSL3 ΔSH3 -EGFP) or the first and second Ena/VASP binding site mutated (NHSL3 ΔFP41/2 -EGFP) or both NHSL3 ΔSH3ΔFP41/2 -EGFP. EGFP-tagged NHSL3 was immunoprecipitated from cell lysates using NHSL3 polyclonal antiserum or normal rabbit IgG as negative control and blots were probed using antibodies against Myc and EGFP. Blot representative of three independent experiments. (C) HEK cells were co-transfected with Myc-tagged CYFIP1, or CYFIP2, or CYFIP1 with Nap1 or CYFIP2 with Nap1 and with EGFP only as control or EGFP-tagged NHSL3 with the Abi SH3 domain binding site mutated (NHSL3 ΔSH3 -EGFP). EGFP-tagged NHSL3 was pulled down from cell lysates using a nanobody against EGFP and blots were probed using antibodies against Myc and EGFP. Representative blots from three independent experiments (CYFIP1), two independent experiments (CYFIP2), and 6 independent experiments (CYFIP1/NAP1 and CYFIP2/NAP1).

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Binding Assay, Immunoprecipitation, Negative Control, Transfection, Control

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A) Schematic overview of the location of EGFP tagged overlapping NHSL3 fragments 1-4 and the GST-tagged NHSL3 fragments 1-6 in full length NHSL3 ΔSH3 -EGFP. The location of the mutated Abi binding site and the two Ena/VASP EVH1 domain binding sites (EVH1) are depicted. The numbering refers to the amino acid numbers at the start and end of each fragment referring to murine NHSL3 isoform c (mmNHSL3 transcript variant 3 with exon1c; Genbank No: NM_001285866). (B) HEK cells were co-transfected with Myc-tagged CYFIP1 and Nap1 and with EGFP only as control or EGFP-tagged NHSL3 with the Abi SH3 domain binding site mutated (NHSL3 ΔSH3 -EGFP) or with NHSL3-fragment 1-4 (for location see (A)). EGFP-tagged NHSL3 proteins were pulled down from cell lysates using a nanobody against EGFP and blots were probed using antibodies against Myc and EGFP. Representative blots from three independent experiments. (C,D) Quantification of the EGFP-trap pulldown of CYFIP1 (C) and NAP1 (D) with NHSL3-EGFP fragments from (B). All measurements were normalised to the expression of CYFIP 1 or NAP1 and the amount of pulled down EGFP proteins. The results are displayed relative to the intensity of the pulldown of full-length NHSL3 ΔSH3 -EGFP. Data taken from three independent experiments and plotted as a bar graph, mean ± SEM. Kruskal-Wallis with Dunn’s multiple comparisons test: ∗P < 0.05. (E,F) HEK cells were co-transfected with Myc-tagged CYFIP1 and Nap1. Proteins from cell lysates were pulled down using purified, bead-immobilised GST-tagged NHSL3 fragments 1-6 (for localisation in full length NHSL3 see A) and blots were probed using antibodies against Myc and GST. Representative blots from three independent experiments.

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Binding Assay, Variant Assay, Transfection, Control, Expressing, Purification

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A,B) HEK cells were co-transfected with Myc-tagged CYFIP2 and Nap1 and with EGFP only as control or EGFP-tagged NHSL3 with the Abi SH3 domain binding site mutated (NHSL3 ΔSH3 -EGFP) or with NHSL3-fragment 1-4 (for location see ( A)). EGFP-tagged NHSL3 proteins were pulled down from cell lysates using a nanobody against EGFP and (A) lysates blots and (B) pulldown blots were probed using antibodies against Myc and EGFP. Representative blots from three independent experiments. (C,D) Quantification of the EGFP-trap pulldown of CYFIP2 (C) and NAP1 (D) with NHSL3-EGFP fragments from (B). All measurements were normalised to the expression of CYFIP2 or NAP1 and the amount of pulled down EGFP proteins. The results are displayed relative to the intensity of the pulldown of full-length NHSL3 ΔSH3 -EGFP. Data taken from three independent experiments and plotted as a bar graph, mean ± SEM. Kruskal-Wallis with Dunn’s multiple comparisons test: *P < 0.05. (E) Coomassie gel of purified GST and the GST-tagged fragments 1-6 and fragment 3 mutated in the Abi SH3 domain binding site. Please note since NHSL3 is intrinsically unstructured, protein degradation is apparent. Data relates to .

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Transfection, Control, Binding Assay, Expressing, Purification

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A) The sequence in the top row is that of mmNHSL3 isoform c, with residues conserved across vertebrate species as determined by MAFFT coloured in magenta. The binding regions identified from biochemical interaction assays are enclosed in red boxes. The second row shows the output of the DeepMSA screen with the size of the amino acid letter corresponding to the conservation at each position. The amino acids are coloured by chemical property, provided by the server ( https://zhanggroup.org/DeepMSA/ ). Annotated underneath the DeepMSA is the secondary structure as predicted by AlphaFold2 from the protein database (Uniprot accession number: A2A7S8). (B) Summary of highly conserved sequences in NHSL3 based on MAFFT and DeepMSA found within the two regions identified from biochemical interaction assays . X = any amino acid; x = any small amino acid; φ = a hydrophobic amino acid; φa = a hydrophobic, aliphatic amino acid; + = a positively charged amino acid; +/– = a charged amino acid. *Extended beyond the interaction regions defined by the fragment binding. (C) A graphical summary of conserved sequences and contact sites in the N-terminal region of NHSL3, with annotations of the real and virtual fragments used for analysis. Real fragments are indicated as SF1-3, virtual fragments are indicated by coloured lines above the sequence: cyan = 1, magenta = 2, green = 3, and dark blue = 4. Conserved sequences, as described in table (B), are indicated by orange amino acid lettering. Sites of contact are indicated by asterisks above the letter indicating the contact residue. Only contact sites that lie within conserved sequences and replicated in two fragments (where possible) are annotated. Data relates to .

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Sequencing, Binding Assay, Residue

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: ( A ) The predicted structure of full-length NHSL3 as displayed on the AlphaFold Protein Structure Database (Uniprot accession number: A2A7S8). The protein is colour coded by a per-residue confidence score (pLDDT) as on the database. ( B ) A model of the N-terminal region of NHSL3 (GST-tagged fragments SF1 and SF2 ). The structure was predicted using ColabFold and visualised in ChimeraX. The model is colour coded with the same palette as the AlphaFold database but is normalised to the range of pLDDT scores within this prediction (min = 29.8, max = 93.5). ( C ) Model predictions of four virtual overlapping fragments of the N-terminal region of NHSL3 in complex with CYFIP1 (full-length). The location and length of the fragments are given in each case (res. = residue, a.a. = amino acid). CYFIP1 is depicted in cyan, and NHSL3 fragments in orange. In each panel, the left-hand side shows an expanded view of the complex, whilst the right-hand side magnifies the regions containing points of inter-chain contact between NHSL3 and CYFIP1. In both cases arrowheads indicate the contact sites, where ball-and-stick displays of the residues in addition to the cartoon ribbon exhibit the atoms involved in the contact. Dashed magenta connecting lines indicate any van der Waals overlap, dashed black lines indicate hydrogen bonds specifically. Capital Roman numerals indicate contacts which occurred in multiple models, and which involve highly conserved sequences, labelled [I] – [IV].

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Residue

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A,B) HEK cells were co-transfected with Myc-tagged CYFIP1 or CYFIP2 (A) or Myc-tagged Nap1, CYFIP1 or CYFIP2, Nap1, Scar/WAVE2, Abi1, and HSPC300 (B) and with EGFP only as control or EGFP-tagged NHSL3 with the Abi SH3 domain binding site mutated (NHSL3 ΔSH3 -EGFP) or EGFP-tagged NHSL3 with the Abi SH3 domain binding site and the seven amino acids mediating CYFIP binding mutated (NHSL3 ΔSH3ΔCYFIP -EGFP). EGFP-tagged NHSL3 proteins were pulled down from cell lysates using a nanobody against EGFP and blots were probed using antibodies against Myc and EGFP. Representative blots from three independent experiments. (C,D) Knockout of NHSL3 causes an increase in Arp2/3 complex activity. ( C ) Lifetime images of wild-type (WT) CRISPR Ctrl, NHSL3 CRISPR KO-1, and NHSL3 CRISPR KO-2 B16-F1 cells expressing the Arp2/3 complex biosensor plated on laminin coated glass. Warm colours indicate short lifetimes, and cool colours long lifetimes, of the donor fluorophore mTurq2. Shorter lifetimes represent higher FRET efficiency and therefore higher Arp2/3 complex activity. Representative images from four independent experiments. ( D ) Quantification of average cellular FRET efficiency (E FRET ) which corresponds to Arp2/3 complex activity in WT CRISPR Ctrl (grey circles), NHSL3 CRISPR KO-1 (pink inverted triangles), and NHSL3 CRISPR KO-2 (green diamonds) cells. Data points are the weighted mean FRET efficiency across each individual cell, and bars represent the population mean ± SEM. Data from four independent experiments (N = 4): n = 34 (WT CRISPR Ctrl), n = 37 (NHSL3 CRISPR KO-1), n = 32 (NHSL3 CRISPR KO-2). Ordinary one-way ANOVA with Dunnett’s multiple comparisons test: ∗∗∗∗P < 0.0001 (WT CRISPR Ctrl <> NHSL3 CRISPR KO-1; WT CRISPR Ctrl <> NHSL3 CRISPR KO-2).

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Transfection, Control, Binding Assay, Knock-Out, Activity Assay, CRISPR, Expressing

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A,B) Genomic DNA was isolated from wild-type B16-F1 cells as well as potential NHSL3 knockout clones, and the region of DNA encompassing the expected cut site in exon 2 was amplified by PCR. These amplicons were sequenced, and DNA Sequences of knock-out clones were compared to WT sequence using the DECODR web tool. (A) 53.4% of alleles in NHSL3 KO1 contain a deletion of 71bp or 46.6% of alleles contain a deletion of 76bp at the cut site resulting in frame shifts and premature termination codons. (B) 50.6% of alleles in NHSL3 KO2 contain a deletion of 1bp or 49.4% of alleles contain a deletion of 16bp at the cut site resulting in frame shifts and premature termination codons. Altered amino acid sequence as a result of the frame shift is shown in red and the premature termination codon is represented with a ‘*’. (C) Wild-type B16-F1 cell or the B16-F1 CRISPR control cell line or NHSL3 CRISPR knockout cell lines NHSL3 KO1 or NHSL3 KO2 were lysed and equal amounts of lysates separated by SDS-PAGE and blotted. Blots were incubated with NHSL3 (upper blot) or HSC70 antibodies as loading control (lower blot). Representative blots from three independent experiments. Data relates to and .

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Isolation, Knock-Out, Clone Assay, Amplification, Sequencing, CRISPR, Control, SDS Page, Incubation

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A) The mean track speed (MTS, dt = 10 mins) of randomly migrating WT CRISPR Ctrl (grey circles), NHSL3 CRISPR KO1 (pink inverted triangles), and NHSL3 CRISPR KO2 (green diamonds) B16-F1 cells plated on fibronectin. Each data point represents the MTS of an individual cell, bars represent the population mean ± SEM. Data taken from six independent experiments (N = 6): n = 69 (WT CRISPR Ctrl), n = 68 (NHSL3 CRISPR KO1), n = 68 (NHSL3 CRISPR KO2) after excluding one data point based on the identification of outliers using the ROUT method with Q = 0.1%. Kruskal-Wallis with Dunn’s multiple comparisons test: ∗∗∗P = 0.0001 (WT CRISPR Ctrl <> NHSL3 CRISPR KO1), *P = 0.0355 (WT CRISPR Ctrl <> NHSL3 CRISPR KO2). (B) The mean track persistence (MTP, TR = 4) of the same cells as in (A). Data points represent the MTP of each individual cell, bars represent the population mean ± SEM. Ordinary one-way ANOVA with Dunnett’s multiple comparisons test: nsP = 0.4866 (WT CRISPR Ctrl <> NHSL3 CRISPR KO1), ns P = 0.6532 (WT CRISPR Ctrl <> NHSL3 CRISPR KO2). (C) The mean track speed (MTS, dt = 10 mins) of randomly migrating B16-F1 cells plated on fibronectin and transiently transfected with either EGFP only as a control (EGFP-Ctrl, grey circles) or NHSL3-EGFP (red inverted triangles) to over-express NHSL3. Each data point represents the MTS of an individual cell, bars represent the population mean ± SEM. Data taken from five independent experiments (N = 5): n = 252 (EGFP-Ctrl), n = 225 (EGFP-NHSL3) after excluding two data points based on the identification of outliers using the ROUT method with Q = 0.1%. Non-parametric rank comparison (Mann-Whitney) test: *P = 0.0122 (EGFP Ctrl <> NHSL3-EGFP). (D) The mean track persistence (MTP, TR = 4) of the same cells as in (C). Data points represent the MTP of each individual cell, bars represent the population mean ± SEM. Unpaired t-test: ns P = 0.6613 (EGFP Ctrl <> NHSL3-EGFP).

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: CRISPR, Transfection, Control, Comparison, MANN-WHITNEY

Journal: bioRxiv

Article Title: NHSL3 interacts with Ena/VASP proteins and the Scar/WAVE complex and promotes cell migration

doi: 10.1101/2025.04.03.647056

Figure Lengend Snippet: (A) B16-F1 cells were either left non-transfected, transfected with EGFP only as negative control or with NHSL3-EGFP, selected by puromycin and lysed. Cell lysates were separated by SDS-PAGE and blotted. Blots were incubated with NHSL3 (upper blot) or HSC70 antibodies as loading control (lower blot). Representative blots from three independent experiments. (B) Schematic diagram of the definition of Mean Track Speed (MTS) and Mean Track Persistence (MTP). See detailed explanation in the methods section. Data relates to .

Article Snippet: We utilised CRISPR-Cas9: Two NHSL3 specific sgRNA (sgRNA1: caccgGCCCTGACGGTTGTCACTCT; sgRNA2: caccgAGCCAGGGGCCAGGATCTGT) were designed using the Zheng lab CRISPR sgRNA design tool https://www.zlab.bio/resources and cloned into pX330A1×2, harboring Cas9. pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766; http://n2t.net/addgene:58766 ; RRID:Addgene_58766).

Techniques: Transfection, Negative Control, SDS Page, Incubation, Control

Journal: Scientific Reports

Article Title: Transiently expressed CRISPR/Cas9 induces wild-type dystrophin in vitro in DMD patient myoblasts carrying duplications

doi: 10.1038/s41598-022-07671-w

Figure Lengend Snippet: Dystrophin correction in immortalized DUPmyo cells electroporated with CRISPR/Cas9-expressing plasmids. ( a ) Schematic of the plasmid where CR0 and CR2 were cloned. ( b ) T7E1 assay performed on HEK293T transfected with the LCR2 plasmid (lentiviral vector expressing sgRNA2), CR0 (negative control plasmid) and CR2 (plasmid expressing sgRNA2). Arrows indicated cleaved bands of expected molecular size in cells expressing the nuclease. LCR2 was used as a reference to evaluate the targeting efficiency of CR2. CR0 did not show cleaved bands as LCR2 and CR2, proving it is a valid negative control for monitoring the targeting effect of CRISPR/Cas9. NT = untreated cells. ( c ) FACS analysis of immortalized DUPmyo-i myoblasts electroporated by NEON. ( d ) T7E1 assay performed on the total pool of electroporated DUPmyo-i cells expressing CR0 and CR2. ( e ) Efficiency of genomic targeting evaluated in T7E1 replicates (n = 3). ( f ) Mutated dystrophin transcript in cells expressing CR0 and CR2 (Kruskall-Wallis test, p = 0.0552) (n = 3 technical replicates/sample). ( g ) Western blot showing dystrophin correction (427 kDa band) in cells expressing CR2. Vinculin (116 KDa band) and meta-vinculin (124 kDa band) were probed as a loading control and a measure of myogenic differentiation, respectively. ( h ) Percentages of mutated dystrophin assessed in electroporated DUPmyo-i (Kruskall-Wallis test, p = 0.0679) (n = 3). i) Comparison of mutated dystrophin observed in patient-myoblasts following LCR2-transduction (n = 4) and CR2 electroporation (n = 3) (Mann–Whitney test, p = 0.4). NT = untreated cells. TotCR0/TotCR2 = total pool of cells expressing CR0/CR2. WT = protein derived from the immortalized murine H2K 2B4 cells, expressing wild-type dystrophin (positive control), LCR2 = transduced cells.

Article Snippet: The best sgRNA (sgRNA2) was also cloned into the integrating pL-CRISPR.EFS.GFP plasmid from Benjamin Ebert’s laboratory (Addgene #57818), following the specified protocol.

Techniques: CRISPR, Expressing, Plasmid Preparation, Clone Assay, Transfection, Negative Control, Western Blot, Control, Comparison, Transduction, Electroporation, MANN-WHITNEY, Derivative Assay, Positive Control